Latest medical glove Tenders | Government medical glove Tenders

Central Government/Public Sector

CTN :45551698

06 Jul, 2026 NA

Samba - Jammu And Kashmir

Tender For supply of blood glucose test strip , blood groupkit , cotton , rapid diagnostic card , disposable syringe , disposable needle , ecg paper roll , ecg paper roll , hiv rdk , hbsag rdk , lancets , malaria card , rapid diagnostic card , surgical sprit , gloves surgical rubber , troponin enzyme test card , urine test strip , typhoid test kit

Central Government/Public Sector

CTN :45512256

02 Jul, 2026 NA

Gwalior - Madhya Pradesh

Tender For supply of cell biological items c c - hacat cells , hff1 cells , dmem, high glucose pyruvate , 5 uaauuucuacuaaguguagau gauccguaaguccaugacgu 3 , 5 uaauuucuacuaaguguagau cuagguaccgacguagcauc 3 , 5 uaauuucuacuaaguguagau cgaugucagcuaagccgucg 3 , 5 uaauuucuacuaaguguagau ggaacguacgugagucguag 3 , 5 uaauuucuacuaaguguagau gcuagacugacgcgaugcug 3 , 5 uaauuucuacuaaguguagau guagcgugacgcgagcuagg 3 , 5 uaauuucuacuaaguguagau acgguccgauagcggacucg 3

Central Government/Public Sector

CTN :45546655

22 Jun, 2026 NA

Lucknow - Uttar Pradesh

Tender For supply of glucose kit (god-pod) with standard for auto analyzer & semi auto analyzer-- incubation time less than or equal to 8 minutes- flow cell temperature 37c -with program sheet for olympus au - 400 [ warranty period: 30 months after the date of delivery ] ]

State Government

CTN :45491316

18 Jun, 2026 8.00 Lacs

Sikar - Rajasthan

Tender For supply of lab items - c.b.c printer roll , edta k 3 vial 2 ml double cap , esr pipte disposable with citrate bulb , ecg jelly , j.s.b. stain 1 & 11 , 3.8 sodium citrate , cappilary tube , filter paper , hb meter , n/10 hcl,hb tube , blood group kit(igg + igm). , cover slips , glass slide , widal kit , vdrl card , hiv card , urine container , urine multi strip(9 strip) sd , urine strip(alb. sugar) , pragnancy card , deionized water(dw) , tissue paper , clinic spirit , cotton roll (500gm) , syringe (2 ml, 3 mi & 5 mi available) , niddle(24 no) lencet , supplies , soup bar , dropper , abx midili (20 ltr.) , abx cleaner (1 ltr.) , abx lyse (1 ltr.) , minicalir (1 ltr.) , c.b.c. control, positive, negative , hbs ag rapid test , glucose kit liquid , blood urea liquid , creatinine liquid , bilirubin liquid , sgot liquid , sgpt liquid , alk. phasptase liquid , total protien liquid , colestrol liquid , trigelsrides(tg) liquid , hdl liquid , vldl liquid , album kit , glucometer strip , plain tube without cap) , plain tube with cap , s. ldh , tips - yellow (1-50 mc itr.) , tips - blue (1 mi.) , plastic tube rack , micro pippte stand , dropping bottle , glass beaker , oil immersion , accu-check (glucometer cell) , total albumin , 10 micro liter fix , 5-50 micro liter (variable) , 10-100 micro liter (variable) , 100-1000 micro liter (variable)

Central Government/Public Sector

CTN :45548852

25 Jun, 2026 NA

Allahabad - Uttar Pradesh

Tender For supply of glucose (liquid), 9x51ml. in per pack. (item no. 4474 (pac) of ami 2026 - 27).[quantity tolerance (+/-): 5 %age , item category : normal , total po value variation permitted: max 8 lacs ] ]

Central Government/Public Sector

CTN :45512021

02 Jul, 2026 9.50 Lacs

Kamrup - Assam

Tender For n hexane , n hexadecane , dipotassium phosphate k 2 hpo 4 , potassium dihydrogen phosphate kh 2 po 4 , magnesium sulfate heptahydrate e- mgso 4 .7 h2o , toluene , xylene , brain heart infusion broth , lb broth , nutrient broth , soluble starch , iodine , skim milk sm agar , d- glucose , dpph 2 2 diphenyl-1-picrylhydrazyl , 2,4,6-tris 2-pyridyl-s- triazinetptz , ferric chloride anhydrous , acetate buffer , ferrous sulfate , triton x-100 octylphenol ethoxylate , dulbeccos modified eagle medium dmem , mrs broth , mrs agar , hydrogen peroxide , glycerol , sodium chloride , potassium chloride , calcium chloride , sodium bicarbonate , methanol , ethanol , peptone powder , yeast extract powder , l-cysteine hydrochloride , magnesium sulfate monohydrate mgso4 h2o , porcine t3 triiodothyronine elisa kit , porcine t4 thyroxine elisa kit , mda malon dialdehyde elisa kit , porcine sod1 superoxide dismutase cu-zn elisa kit , porcine cat catalase elisa kit , porcine igg immunoglobulin g elisa kit , porcine il-10 interleukin 10 elisa kit , porcine cortisol elisa kit , porcine tnf- tumor necrosis factor alpha elisa kit , porcine il-1 interleukin 1 alpha elisa kit , molecular grade ethanol , ethidium bromide , agarose powder , 10 x tae buffer , pcr master mix , nuclease free water , rna extraction kit , cdna synthesis kit , histopaque , chloroform , isopropanol , trizol , microcentrifuge tubes zero point five ml , microcentrifuge tubes 0.2 ml , pcr tube strips , microcentrifuge tubes 2 ml , microtube rack , pcr tube rack , pipette tips-10 microlitre , pipette tips-200 microlitre , pipette tips-1000microlitre , pipette holder , gloves , slide storage box , cryo box , cryo tags , petridish , glass wash bottle set 500 ml , burette 50 ml , volumetric flask 100 ml , sodium hydroxide pellets 5 kg , hydrochloric acid hcl 2.5 lit , sulphuric acid 2.5 lit , nitric acid 2.5 lit , perchloric acid 2.5 lit , petroleum ether 2.5 lit

Central Government/Public Sector

CTN :45302476

16 Jun, 2026 1.31 Lacs

Ganjam - Odisha

Tender For corrigendum : supply of urea kit , sgpt kit , sgot kit , creatinine kit , glucose kit , alkaline phosphatase kit , cholesterol kit , triglycerides kit , widal kit , bilirubin kit t and d , dispo van syringe 3.0 ml , plain vacutainer , sodium fluoride vacutainer , k3 edta vacutainer , sodium citrate 3.8 percent vacutainer , micro- tips 2-200 micro lit , uristix , uric acid kit , hemocor-d with standard , surgical spirit , cardigel , labolene , abo anti sera , leishmans stain solution , glucostrip , absorbent cotton 500 gm , glass slide pic-2 , test tube glass 12x75 mm , alcohol swab , spot band-aid , mal card , disposable esr pipette , hdl cholesterol kit , dispovan needle 23g x 1 inch

Central Government / Public Sector

CTN :44610237

15 Jun, 2026 7.95 Lacs

Kolkata - West Bengal

Tender For bid to ras bid to ras supply of glucose reagent hexokinase 5x44 ml or 5 x 12.5ml erba , hiv tri dot 50 test rapid kit j mitra , urea reagent erba r1- 5 x 44 ml or r2- 5 x 11 ml , erbaqik hbs ag erba , erba mannheim biochemistry reagent kit creatinine enzymatic 5x30ml or 5x10 , erba mannheim urine test strip multistix 100 per kit , malaria rapid test kit j.mitra , erba mannheim biochemistry reagent kit , sgpt 6x44 or 6x12.5ml , erba mannheim biochemistry reagent kit , sgot 6x44 or 6x12.5ml , aso titre for 25test latex arkray , erba mannheim alkaline phosphatase small system pack 5 x 22 ml or 5x6.8ml , glass slide 50 per box , erba c r p xl crp- turbilatex with calibrator 2x22ml and 2x6.7ml , uric acid erba r1- 5 x 44 ml or r2- 5 x 11 ml , erba mannheim biochemistry reagent kit , total protein 10x44ml , erba mannheim biochemistry reagent kit , albumin 5x22ml , j.mitra dengue rapid test kit ns1 antigen 25 tests per kit , j.mitra h c v rapid test kit 50 tests per kit , urine,stool,container b positive urine culture bottle 30 ml 25 per pack , himedia technical grade buffer solutions, size 500 milliliter per bott. , disposable vaccum esr pipette pack of 100 , bd blood specimen collection tube vacum clot activator plain vial 100 per box , bd blood specimen collection tube vacum edta vial 100 per box , bd vacuum blood collection tubes sodium fluoride and edta 2 milliliter 100 per box , erba serum bilirubin direct kit system pack 6 x 44 ml or 6 x 12.3ml , erba serum total bilirubin kit system pack 6 x 44 ml or 6 x 12.3 ml , vaccutainer needle blood collection needle 22g 100 per box , erba mannheim serum triglyceride kit r1- 5 x 44 ml or r2- 5 x 11 ml , tarsons virgin polypropylene snap cap centrifuge tubes tarsons 500 per box , erba mannheim urine test strip material- plastic erba mannheimr glucose and ketone test strips 100 per kit , widal test kit slide test 4 antigen set s. typhi o,s. typhi h, s. paratyphi ah and s. paratyphi bh 5ml x 4 , cdh type a microscope immersion oil, size 50ml in plastic bottle 50ml bottle , pregnancy rapid test kit pak of 10 kit , glass straight funnel 1 x 1 , black marker pen 1 x 1 , erbaqik dengue ns1 antigen and igm plus igg antibody detection rapid test kit of 10 test , erbaqik syphilis antibody rapid test kit of 25 test , erbaa mannheim biochemistry reagent kit , ldl cholesterol 2x30ml or 2x10ml , erba mannheim biochemistry reagent kit hdl cholesterol 4x30ml or 4x10ml , coral cholesterol reagent 10x44ml , erba mannheim biochemistry reagent kit , rf 1x22ml or 1x5.5ml , ethanol absolute ar 1 ltr bott , tourniket , sodium hypochlorite solution 4 percent 1 ltr bott , siemens urine test strips combistix 100 strips per kit , haemospot for occult blood 50 test per kit or coral 50 per kit , cell pack 20 ltr. sysmex 20 ltr per pack , cell clean sysmex 50ml per kit , stromatolyser wh sysmex 500ml per kit , printing paper roll for sysmex xp 100 roll , ppd 5 tu 5ml arkray 5ml per kit , control sera for biochemical test for low bio-rad kit of 5ml x 12 , control sera for biochemical test for high bio-rad kit of 5 ml x 12 , eight check 3wp tri level control for haematology sysmex 2ml x3 per kit , lens cleaning tissue paper , erba xl wash kit 100ml x10 per kit , multical transasia 3ml x 4 per kit , seroquant r.a. control level 1 , seroquant crp control level 1 , vaccutainer needle holder , sulphuric acid 20 percent bott of 100 ml , test tube cleaning brush , conical centrifuge tube glass 15ml borosil , microtips 200 - 1000 microlitre box of 500 , erba auto wash ac or al 5x44ml //bid details 2 / 41

CTN :45551746

25 Jun, 2026 NA

Mathura - Uttar Pradesh

Tender For supply of ready made water culture pa e coli kit for detection of presence or absence of coliform bacteria in water , oral glucose powder , tissue paper roll , medicated dressing spot handiplast round pack of 100 , ahg gel card pack of 24 test , ethyl alcohol , widal test kit , reticulocytes count stain 100ml , easylite trilevel control of 3x10ml , multistix 10sg pack size 1x100 strips , thermal printer paper roll pack size roll , check stix combo pack control , uniplastin pack size 12x5ml , liquicillin pack size 3ml , elite 580 control h n l , calibrator elite 580 , ebra h 360 calibrator and qc , erba h 360 control h n l , crp latex reagent , single reaction cuvette src ebra , sample detector electrolyte analyser , rf latex kit , urine strips , ppd vial of 10 ml , pm kit for erba 200 , elite 580 lyse i , elite 580 lyse ii , elite 580 lyse iii

CTN :45543928

23 Jun, 2026 1.78 Lacs

Bareilly - Uttar Pradesh

Tender For supply of kits for estimation of cholesterol 100ml , kits for estimation of glucose 400ml , drabkins solution , strips albumin and glucose bott of 100 strips , urine collection bott 50ml , syringe disposable plastic sterile 5 ml with needle , tube test 100 mm x 12 mm rimless , cell pack pack of 20 ltr , cell clean bott of 50ml , stromatolyser bott of 500ml

Medical Glove Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors